Repository URL to install this package:
|
Version:
1.87 ▾
|
biopython
/
SeqFeature.py
|
|---|
# Copyright 2000-2003 Jeff Chang.
# Copyright 2001-2008 Brad Chapman.
# Copyright 2005-2024 by Peter Cock.
# Copyright 2006-2009 Michiel de Hoon.
# All rights reserved.
#
# This file is part of the Biopython distribution and governed by your
# choice of the "Biopython License Agreement" or the "BSD 3-Clause License".
# Please see the LICENSE file that should have been included as part of this
# package.
"""Represent a Sequence Feature holding info about a part of a sequence.
This is heavily modeled after the Biocorba SeqFeature objects, and
may be pretty biased towards GenBank stuff since I'm writing it
for the GenBank parser output...
What's here:
Base class to hold a Feature
----------------------------
Classes:
- SeqFeature
Hold information about a Reference
----------------------------------
This is an attempt to create a General class to hold Reference type
information.
Classes:
- Reference
Specify locations of a feature on a Sequence
--------------------------------------------
This aims to handle, in Ewan Birney's words, 'the dreaded fuzziness issue'.
This has the advantages of allowing us to handle fuzzy stuff in case anyone
needs it, and also be compatible with BioPerl etc and BioSQL.
Classes:
- Location - abstract base class of SimpleLocation and CompoundLocation.
- SimpleLocation - Specify the start and end location of a feature.
- CompoundLocation - Collection of SimpleLocation objects (for joins etc).
- Position - abstract base class of ExactPosition, WithinPosition,
BetweenPosition, AfterPosition, OneOfPosition, UncertainPosition, and
UnknownPosition.
- ExactPosition - Specify the position as being exact.
- WithinPosition - Specify a position occurring within some range.
- BetweenPosition - Specify a position occurring between a range (OBSOLETE?).
- BeforePosition - Specify the position as being found before some base.
- AfterPosition - Specify the position as being found after some base.
- OneOfPosition - Specify a position consisting of multiple alternative positions.
- UncertainPosition - Specify a specific position which is uncertain.
- UnknownPosition - Represents missing information like '?' in UniProt.
Exceptions:
- LocationParserError - Exception indicating a failure to parse a location
string.
"""
import functools
import re
import warnings
from abc import ABC
from abc import abstractmethod
from Bio import BiopythonParserWarning
from Bio.Seq import MutableSeq
from Bio.Seq import reverse_complement
from Bio.Seq import Seq
# Regular expressions for location parsing
_reference = r"(?:[a-zA-Z][a-zA-Z0-9_\.\|]*[a-zA-Z0-9]?\:)"
_oneof_position = r"one\-of\(\d+[,\d+]+\)"
_oneof_location = rf"[<>]?(?:\d+|{_oneof_position})\.\.[<>]?(?:\d+|{_oneof_position})"
_any_location = rf"({_reference}?{_oneof_location}|complement\({_oneof_location}\)|[^,]+|complement\([^,]+\))"
_split = re.compile(_any_location).split
assert _split("123..145")[1::2] == ["123..145"]
assert _split("123..145,200..209")[1::2] == ["123..145", "200..209"]
assert _split("one-of(200,203)..300")[1::2] == ["one-of(200,203)..300"]
assert _split("complement(123..145),200..209")[1::2] == [
"complement(123..145)",
"200..209",
]
assert _split("123..145,one-of(200,203)..209")[1::2] == [
"123..145",
"one-of(200,203)..209",
]
assert _split("123..145,one-of(200,203)..one-of(209,211),300")[1::2] == [
"123..145",
"one-of(200,203)..one-of(209,211)",
"300",
]
assert _split("123..145,complement(one-of(200,203)..one-of(209,211)),300")[1::2] == [
"123..145",
"complement(one-of(200,203)..one-of(209,211))",
"300",
]
assert _split("123..145,200..one-of(209,211),300")[1::2] == [
"123..145",
"200..one-of(209,211)",
"300",
]
assert _split("123..145,200..one-of(209,211)")[1::2] == [
"123..145",
"200..one-of(209,211)",
]
assert _split(
"complement(149815..150200),complement(293787..295573),NC_016402.1:6618..6676,181647..181905"
)[1::2] == [
"complement(149815..150200)",
"complement(293787..295573)",
"NC_016402.1:6618..6676",
"181647..181905",
]
_pair_location = r"[<>]?-?\d+\.\.[<>]?-?\d+"
_between_location = r"\d+\^\d+"
_within_position = r"\(\d+\.\d+\)"
_within_location = r"([<>]?\d+|%s)\.\.([<>]?\d+|%s)" % (
_within_position,
_within_position,
)
_within_position = r"\((\d+)\.(\d+)\)"
_re_within_position = re.compile(_within_position)
assert _re_within_position.match("(3.9)")
_oneof_location = r"([<>]?\d+|%s)\.\.([<>]?\d+|%s)" % (_oneof_position, _oneof_position)
_oneof_position = r"one\-of\((\d+[,\d+]+)\)"
_re_oneof_position = re.compile(_oneof_position)
assert _re_oneof_position.match("one-of(6,9)")
assert not _re_oneof_position.match("one-of(3)")
assert _re_oneof_position.match("one-of(3,6)")
assert _re_oneof_position.match("one-of(3,6,9)")
_solo_location = r"[<>]?\d+"
_solo_bond = r"bond\(%s\)" % _solo_location
_re_location_category = re.compile(
r"^(?P<pair>%s)|(?P<between>%s)|(?P<within>%s)|(?P<oneof>%s)|(?P<bond>%s)|(?P<solo>%s)$"
% (
_pair_location,
_between_location,
_within_location,
_oneof_location,
_solo_bond,
_solo_location,
)
)
class LocationParserError(ValueError):
"""Could not parse a feature location string."""
class SeqFeature:
"""Represent a Sequence Feature on an object.
Attributes:
- location - the location of the feature on the sequence (SimpleLocation)
- type - the specified type of the feature (ie. CDS, exon, repeat...)
- id - A string identifier for the feature.
- qualifiers - A dictionary of qualifiers on the feature. These are
analogous to the qualifiers from a GenBank feature table. The keys of
the dictionary are qualifier names, the values are the qualifier
values.
"""
def __init__(
self,
location=None,
type="",
id="<unknown id>",
qualifiers=None,
sub_features=None,
):
"""Initialize a SeqFeature on a sequence.
location can either be a SimpleLocation (with strand argument also
given if required), or None.
e.g. With no strand, on the forward strand, and on the reverse strand:
>>> from Bio.SeqFeature import SeqFeature, SimpleLocation
>>> f1 = SeqFeature(SimpleLocation(5, 10), type="domain")
>>> f1.location.strand == None
True
>>> f2 = SeqFeature(SimpleLocation(7, 110, strand=1), type="CDS")
>>> f2.location.strand == +1
True
>>> f3 = SeqFeature(SimpleLocation(9, 108, strand=-1), type="CDS")
>>> f3.location.strand == -1
True
For exact start/end positions, an integer can be used (as shown above)
as shorthand for the ExactPosition object. For non-exact locations, the
SimpleLocation must be specified via the appropriate position objects.
"""
if (
location is not None
and not isinstance(location, SimpleLocation)
and not isinstance(location, CompoundLocation)
):
raise TypeError(
"SimpleLocation, CompoundLocation (or None) required for the location"
)
self.location = location
self.type = type
self.id = id
self.qualifiers = {}
if qualifiers is not None:
self.qualifiers.update(qualifiers)
if sub_features is not None:
raise TypeError("Rather than sub_features, use a CompoundLocation")
def __eq__(self, other):
"""Check if two SeqFeature objects should be considered equal."""
return (
isinstance(other, SeqFeature)
and self.id == other.id
and self.type == other.type
and self.location == other.location
and self.qualifiers == other.qualifiers
)
def __repr__(self):
"""Represent the feature as a string for debugging."""
answer = f"{self.__class__.__name__}({self.location!r}"
if self.type:
answer += f", type={self.type!r}"
if self.id and self.id != "<unknown id>":
answer += f", id={self.id!r}"
if self.qualifiers:
answer += ", qualifiers=..."
answer += ")"
return answer
def __str__(self):
"""Return the full feature as a python string."""
out = f"type: {self.type}\n"
out += f"location: {self.location}\n"
if self.id and self.id != "<unknown id>":
out += f"id: {self.id}\n"
out += "qualifiers:\n"
for qual_key in sorted(self.qualifiers):
out += f" Key: {qual_key}, Value: {self.qualifiers[qual_key]}\n"
return out
def _shift(self, offset):
"""Return a copy of the feature with its location shifted (PRIVATE).
The annotation qualifiers are copied.
"""
return SeqFeature(
location=self.location._shift(offset),
type=self.type,
id=self.id,
qualifiers=self.qualifiers.copy(),
)
def _flip(self, length):
"""Return a copy of the feature with its location flipped (PRIVATE).
The argument length gives the length of the parent sequence. For
example a location 0..20 (+1 strand) with parent length 30 becomes
after flipping 10..30 (-1 strand). Strandless (None) or unknown
strand (0) remain like that - just their end points are changed.
The annotation qualifiers are copied.
"""
return SeqFeature(
location=self.location._flip(length),
type=self.type,
id=self.id,
qualifiers=self.qualifiers.copy(),
)
def extract(self, parent_sequence, references=None):
"""Extract the feature's sequence from supplied parent sequence.
The parent_sequence can be a Seq like object or a string, and will
generally return an object of the same type. The exception to this is
a MutableSeq as the parent sequence will return a Seq object.
This should cope with complex locations including complements, joins
and fuzzy positions. Even mixed strand features should work! This
also covers features on protein sequences (e.g. domains), although
here reverse strand features are not permitted. If the
location refers to other records, they must be supplied in the
optional dictionary references.
>>> from Bio.Seq import Seq
>>> from Bio.SeqFeature import SeqFeature, SimpleLocation
>>> seq = Seq("MKQHKAMIVALIVICITAVVAAL")
>>> f = SeqFeature(SimpleLocation(8, 15), type="domain")
>>> f.extract(seq)
Seq('VALIVIC')
If the SimpleLocation is None, e.g. when parsing invalid locus
locations in the GenBank parser, extract() will raise a ValueError.
>>> from Bio.Seq import Seq
>>> from Bio.SeqFeature import SeqFeature
>>> seq = Seq("MKQHKAMIVALIVICITAVVAAL")
>>> f = SeqFeature(None, type="domain")
>>> f.extract(seq)
Traceback (most recent call last):
...
ValueError: The feature's .location is None. Check the sequence file for a valid location.
Note - currently only compound features of type "join" are supported.
"""
if self.location is None:
raise ValueError(
"The feature's .location is None. Check the "
"sequence file for a valid location."
)
return self.location.extract(parent_sequence, references=references)
def translate(
self,
parent_sequence,
table="Standard",
start_offset=None,
stop_symbol="*",
to_stop=False,
cds=None,
gap=None,
):
"""Get a translation of the feature's sequence.
This method is intended for CDS or other features that code proteins
and is a shortcut that will both extract the feature and
translate it, taking into account the codon_start and transl_table
qualifiers, if they are present. If they are not present the
value of the arguments "table" and "start_offset" are used.
The "cds" parameter is set to "True" if the feature is of type
"CDS" but can be overridden by giving an explicit argument.
The arguments stop_symbol, to_stop and gap have the same meaning
as Seq.translate, refer to that documentation for further information.
Arguments:
- parent_sequence - A DNA or RNA sequence.
- table - Which codon table to use if there is no transl_table
qualifier for this feature. This can be either a name
(string), an NCBI identifier (integer), or a CodonTable
object (useful for non-standard genetic codes). This
defaults to the "Standard" table.
- start_offset - offset at which the first complete codon of a
coding feature can be found, relative to the first base of
that feature. Has a valid value of 0, 1 or 2. NOTE: this
uses python's 0-based numbering whereas the codon_start
qualifier in files from NCBI use 1-based numbering.
Will override a codon_start qualifier
>>> from Bio.Seq import Seq
>>> from Bio.SeqFeature import SeqFeature, SimpleLocation
>>> seq = Seq("GGTTACACTTACCGATAATGTCTCTGATGA")
>>> f = SeqFeature(SimpleLocation(0, 30), type="CDS")
>>> f.qualifiers['transl_table'] = [11]
Note that features of type CDS are subject to the usual
checks at translation. But you can override this behavior
by giving explicit arguments:
>>> f.translate(seq, cds=False)
Seq('GYTYR*CL**')
Now use the start_offset argument to change the frame. Note
this uses python 0-based numbering.
>>> f.translate(seq, start_offset=1, cds=False)
Seq('VTLTDNVSD')
Alternatively use the codon_start qualifier to do the same
thing. Note: this uses 1-based numbering, which is found
in files from NCBI.
>>> f.qualifiers['codon_start'] = [2]
>>> f.translate(seq, cds=False)
Seq('VTLTDNVSD')
"""
# see if this feature should be translated in a different
# frame using the "codon_start" qualifier
if start_offset is None:
try:
start_offset = int(self.qualifiers["codon_start"][0]) - 1
except KeyError:
start_offset = 0
if start_offset not in [0, 1, 2]:
raise ValueError(
"The start_offset must be 0, 1, or 2. "
f"The supplied value is {start_offset}. "
"Check the value of either the codon_start qualifier "
"or the start_offset argument"
)
feat_seq = self.extract(parent_sequence)[start_offset:]
codon_table = self.qualifiers.get("transl_table", [table])[0]
if cds is None:
cds = self.type == "CDS"
return feat_seq.translate(
table=codon_table,
stop_symbol=stop_symbol,
to_stop=to_stop,
cds=cds,
gap=gap,
)
def __bool__(self):
"""Boolean value of an instance of this class (True).
This behavior is for backwards compatibility, since until the
__len__ method was added, a SeqFeature always evaluated as True.
Note that in comparison, Seq objects, strings, lists, etc, will all
evaluate to False if they have length zero.
WARNING: The SeqFeature may in future evaluate to False when its
length is zero (in order to better match normal python behavior)!
"""
return True
def __len__(self):
"""Return the length of the region where the feature is located.
>>> from Bio.Seq import Seq
>>> from Bio.SeqFeature import SeqFeature, SimpleLocation
>>> seq = Seq("MKQHKAMIVALIVICITAVVAAL")
>>> f = SeqFeature(SimpleLocation(8, 15), type="domain")
>>> len(f)
7
>>> f.extract(seq)
Seq('VALIVIC')
>>> len(f.extract(seq))
7
This is a proxy for taking the length of the feature's location:
>>> len(f.location)
7
For simple features this is the same as the region spanned (end
position minus start position using Pythonic counting). However, for
a compound location (e.g. a CDS as the join of several exons) the
gaps are not counted (e.g. introns). This ensures that len(f) matches
len(f.extract(parent_seq)), and also makes sure things work properly
with features wrapping the origin etc.
"""
return len(self.location)
def __iter__(self):
"""Iterate over the parent positions within the feature.
The iteration order is strand aware, and can be thought of as moving
along the feature using the parent sequence coordinates:
>>> from Bio.SeqFeature import SeqFeature, SimpleLocation
>>> f = SeqFeature(SimpleLocation(5, 10, strand=-1), type="domain")
>>> len(f)
5
>>> for i in f: print(i)
9
8
7
6
5
>>> list(f)
[9, 8, 7, 6, 5]
This is a proxy for iterating over the location,
>>> list(f.location)
[9, 8, 7, 6, 5]
"""
return iter(self.location)
def __contains__(self, value):
"""Check if an integer position is within the feature.
>>> from Bio.SeqFeature import SeqFeature, SimpleLocation
>>> f = SeqFeature(SimpleLocation(5, 10, strand=-1), type="domain")
>>> len(f)
5
>>> [i for i in range(15) if i in f]
[5, 6, 7, 8, 9]
For example, to see which features include a SNP position, you could
use this:
>>> from Bio import SeqIO
>>> record = SeqIO.read("GenBank/NC_000932.gb", "gb")
>>> for f in record.features:
... if 1750 in f:
... print("%s %s" % (f.type, f.location))
source [0:154478](+)
gene [1716:4347](-)
tRNA join{[4310:4347](-), [1716:1751](-)}
Note that for a feature defined as a join of several subfeatures (e.g.
the union of several exons) the gaps are not checked (e.g. introns).
In this example, the tRNA location is defined in the GenBank file as
complement(join(1717..1751,4311..4347)), so that position 1760 falls
in the gap:
>>> for f in record.features:
... if 1760 in f:
... print("%s %s" % (f.type, f.location))
source [0:154478](+)
gene [1716:4347](-)
Note that additional care may be required with fuzzy locations, for
example just before a BeforePosition:
>>> from Bio.SeqFeature import SeqFeature, SimpleLocation
>>> from Bio.SeqFeature import BeforePosition
>>> f = SeqFeature(SimpleLocation(BeforePosition(3), 8), type="domain")
>>> len(f)
5
>>> [i for i in range(10) if i in f]
[3, 4, 5, 6, 7]
Note that is is a proxy for testing membership on the location.
>>> [i for i in range(10) if i in f.location]
[3, 4, 5, 6, 7]
"""
return value in self.location
# --- References
# TODO -- Will this hold PubMed and Medline information decently?
class Reference:
"""Represent a Generic Reference object.
Attributes:
- location - A list of Location objects specifying regions of
the sequence that the references correspond to. If no locations are
specified, the entire sequence is assumed.
- authors - A big old string, or a list split by author, of authors
for the reference.
- title - The title of the reference.
- journal - Journal the reference was published in.
- medline_id - A medline reference for the article.
- pubmed_id - A pubmed reference for the article.
- comment - A place to stick any comments about the reference.
"""
def __init__(self):
"""Initialize the class."""
self.location = []
self.authors = ""
self.consrtm = ""
self.title = ""
self.journal = ""
self.medline_id = ""
self.pubmed_id = ""
self.comment = ""
def __str__(self):
"""Return the full Reference object as a python string."""
out = ""
for single_location in self.location:
out += f"location: {single_location}\n"
out += f"authors: {self.authors}\n"
if self.consrtm:
out += f"consrtm: {self.consrtm}\n"
out += f"title: {self.title}\n"
out += f"journal: {self.journal}\n"
out += f"medline id: {self.medline_id}\n"
out += f"pubmed id: {self.pubmed_id}\n"
out += f"comment: {self.comment}\n"
return out
def __repr__(self):
"""Represent the Reference object as a string for debugging."""
# TODO - Update this is __init__ later accepts values
return f"{self.__class__.__name__}(title={self.title!r}, ...)"
def __eq__(self, other):
"""Check if two Reference objects should be considered equal.
Note prior to Biopython 1.70 the location was not compared, as
until then __eq__ for the SimpleLocation class was not defined.
"""
return (
self.authors == other.authors
and self.consrtm == other.consrtm
and self.title == other.title
and self.journal == other.journal
and self.medline_id == other.medline_id
and self.pubmed_id == other.pubmed_id
and self.comment == other.comment
and self.location == other.location
)
# --- Handling feature locations
class Location(ABC):
"""Abstract base class representing a location."""
@abstractmethod
def __repr__(self):
"""Represent the Location object as a string for debugging."""
return f"{self.__class__.__name__}(...)"
@staticmethod
def fromstring(text, length=None, circular=False, stranded=True):
"""Create a Location object from a string.
This should accept any valid location string in the INSDC Feature Table
format (https://www.insdc.org/submitting-standards/feature-table/) as
used in GenBank, DDBJ and EMBL files.
Simple examples:
>>> Location.fromstring("123..456", 1000)
SimpleLocation(ExactPosition(122), ExactPosition(456), strand=1)
>>> Location.fromstring("complement(<123..>456)", 1000)
SimpleLocation(BeforePosition(122), AfterPosition(456), strand=-1)
A more complex location using within positions,
>>> Location.fromstring("(9.10)..(20.25)", 1000)
SimpleLocation(WithinPosition(8, left=8, right=9), WithinPosition(25, left=20, right=25), strand=1)
Notice how that will act as though it has overall start 8 and end 25.
Zero length between feature,
>>> Location.fromstring("123^124", 1000)
SimpleLocation(ExactPosition(123), ExactPosition(123), strand=1)
The expected sequence length is needed for a special case, a between
position at the start/end of a circular genome:
>>> Location.fromstring("1000^1", 1000)
SimpleLocation(ExactPosition(1000), ExactPosition(1000), strand=1)
Apart from this special case, between positions P^Q must have P+1==Q,
>>> Location.fromstring("123^456", 1000)
Traceback (most recent call last):
...
Bio.SeqFeature.LocationParserError: invalid feature location '123^456'
You can optionally provide a reference name:
>>> Location.fromstring("AL391218.9:105173..108462", 2000000)
SimpleLocation(ExactPosition(105172), ExactPosition(108462), strand=1, ref='AL391218.9')
>>> Location.fromstring("<2644..159", 2868, "circular")
CompoundLocation([SimpleLocation(BeforePosition(2643), ExactPosition(2868), strand=1), SimpleLocation(ExactPosition(0), ExactPosition(159), strand=1)], 'join')
"""
if text.startswith("complement("):
if text[-1] != ")":
raise ValueError(f"closing bracket missing in '{text}'")
text = text[11:-1]
strand = -1
elif stranded:
strand = 1
else:
strand = None
# Determine if we have a simple location or a compound location
if text.startswith("join("):
operator = "join"
parts = _split(text[5:-1])[1::2]
# assert parts[0] == "" and parts[-1] == ""
elif text.startswith("order("):
operator = "order"
parts = _split(text[6:-1])[1::2]
# assert parts[0] == "" and parts[-1] == ""
elif text.startswith("bond("):
operator = "bond"
parts = _split(text[5:-1])[1::2]
# assert parts[0] == "" and parts[-1] == ""
else:
loc = SimpleLocation.fromstring(text, length, circular)
loc.strand = strand
if strand == -1:
loc.parts.reverse()
return loc
locs = []
for part in parts:
loc = SimpleLocation.fromstring(part, length, circular)
if loc is None:
break
if loc.strand == -1:
if strand == -1:
raise LocationParserError("double complement in '{text}'?")
else:
loc.strand = strand
locs.extend(loc.parts)
else:
if len(locs) == 1:
return loc
# Historically a join on the reverse strand has been represented
# in Biopython with both the parent SeqFeature and its children
# (the exons for a CDS) all given a strand of -1. Likewise, for
# a join feature on the forward strand they all have strand +1.
# However, we must also consider evil mixed strand examples like
# this, join(complement(69611..69724),139856..140087,140625..140650)
if strand == -1:
# Whole thing was wrapped in complement(...)
for loc in locs:
assert loc.strand == -1
# Reverse the backwards order used in GenBank files
# with complement(join(...))
locs = locs[::-1]
return CompoundLocation(locs, operator=operator)
# Not recognized
if "order" in text and "join" in text:
# See Bug 3197
raise LocationParserError(
f"failed to parse feature location '{text}' containing a combination of 'join' and 'order' (nested operators) are illegal"
)
# See issue #937. Note that NCBI has already fixed this record.
if ",)" in text:
warnings.warn(
"Dropping trailing comma in malformed feature location",
BiopythonParserWarning,
)
text = text.replace(",)", ")")
return Location.fromstring(text)
raise LocationParserError(f"failed to parse feature location '{text}'")
class SimpleLocation(Location):
"""Specify the location of a feature along a sequence.
The SimpleLocation is used for simple continuous features, which can
be described as running from a start position to and end position
(optionally with a strand and reference information). More complex
locations made up from several non-continuous parts (e.g. a coding
sequence made up of several exons) are described using a SeqFeature
with a CompoundLocation.
Note that the start and end location numbering follow Python's scheme,
thus a GenBank entry of 123..150 (one based counting) becomes a location
of [122:150] (zero based counting).
>>> from Bio.SeqFeature import SimpleLocation
>>> f = SimpleLocation(122, 150)
>>> print(f)
[122:150]
>>> print(f.start)
122
>>> print(f.end)
150
>>> print(f.strand)
None
Note the strand defaults to None. If you are working with nucleotide
sequences you'd want to be explicit if it is the forward strand:
>>> from Bio.SeqFeature import SimpleLocation
>>> f = SimpleLocation(122, 150, strand=+1)
>>> print(f)
[122:150](+)
>>> print(f.strand)
1
Note that for a parent sequence of length n, the SimpleLocation
start and end must satisfy the inequality 0 <= start <= end <= n.
This means even for features on the reverse strand of a nucleotide
sequence, we expect the 'start' coordinate to be less than the
'end'.
>>> from Bio.SeqFeature import SimpleLocation
>>> r = SimpleLocation(122, 150, strand=-1)
>>> print(r)
[122:150](-)
>>> print(r.start)
122
>>> print(r.end)
150
>>> print(r.strand)
-1
i.e. Rather than thinking of the 'start' and 'end' biologically in a
strand aware manner, think of them as the 'left most' or 'minimum'
boundary, and the 'right most' or 'maximum' boundary of the region
being described. This is particularly important with compound
locations describing non-continuous regions.
In the example above we have used standard exact positions, but there
are also specialised position objects used to represent fuzzy positions
as well, for example a GenBank location like complement(<123..150)
would use a BeforePosition object for the start.
"""
def __init__(self, start, end, strand=None, ref=None, ref_db=None):
"""Initialize the class.
start and end arguments specify the values where the feature begins
and ends. These can either by any of the ``*Position`` objects that
inherit from Position, or can just be integers specifying the position.
In the case of integers, the values are assumed to be exact and are
converted in ExactPosition arguments. This is meant to make it easy
to deal with non-fuzzy ends.
i.e. Short form:
>>> from Bio.SeqFeature import SimpleLocation
>>> loc = SimpleLocation(5, 10, strand=-1)
>>> print(loc)
[5:10](-)
Explicit form:
>>> from Bio.SeqFeature import SimpleLocation, ExactPosition
>>> loc = SimpleLocation(ExactPosition(5), ExactPosition(10), strand=-1)
>>> print(loc)
[5:10](-)
Other fuzzy positions are used similarly,
>>> from Bio.SeqFeature import SimpleLocation
>>> from Bio.SeqFeature import BeforePosition, AfterPosition
>>> loc2 = SimpleLocation(BeforePosition(5), AfterPosition(10), strand=-1)
>>> print(loc2)
[<5:>10](-)
For nucleotide features you will also want to specify the strand,
use 1 for the forward (plus) strand, -1 for the reverse (negative)
strand, 0 for stranded but strand unknown (? in GFF3), or None for
when the strand does not apply (dot in GFF3), e.g. features on
proteins.
>>> loc = SimpleLocation(5, 10, strand=+1)
>>> print(loc)
[5:10](+)
>>> print(loc.strand)
1
Normally feature locations are given relative to the parent
sequence you are working with, but an explicit accession can
be given with the optional ref and db_ref strings:
>>> loc = SimpleLocation(105172, 108462, ref="AL391218.9", strand=1)
>>> print(loc)
AL391218.9[105172:108462](+)
>>> print(loc.ref)
AL391218.9
"""
# TODO - Check 0 <= start <= end (<= length of reference)
if isinstance(start, Position):
self._start = start
elif isinstance(start, int):
self._start = ExactPosition(start)
else:
raise TypeError(f"start={start!r} {type(start)}")
if isinstance(end, Position):
self._end = end
elif isinstance(end, int):
self._end = ExactPosition(end)
else:
raise TypeError(f"end={end!r} {type(end)}")
if (
isinstance(self.start, int)
and isinstance(self.end, int)
and self.start > self.end
):
raise ValueError(
f"End location ({self.end}) must be greater than "
f"or equal to start location ({self.start})"
)
self.strand = strand
self.ref = ref
self.ref_db = ref_db
@staticmethod
def fromstring(text, length=None, circular=False):
"""Create a SimpleLocation object from a string."""
if text.startswith("complement("):
text = text[11:-1]
strand = -1
else:
strand = None
# Try simple cases first for speed
try:
s, e = text.split("..")
s = int(s) - 1
e = int(e)
except ValueError:
pass
else:
if 0 <= s < e:
return SimpleLocation(s, e, strand)
# Try general case
try:
ref, text = text.split(":")
except ValueError:
ref = None
m = _re_location_category.match(text)
if m is None:
raise LocationParserError(f"Could not parse feature location '{text}'")
for key, value in m.groupdict().items():
if value is not None:
break
assert value == text
if key == "bond":
# e.g. bond(196)
warnings.warn(
"Dropping bond qualifier in feature location",
BiopythonParserWarning,
)
text = text[5:-1]
s_pos = Position.fromstring(text, -1)
e_pos = Position.fromstring(text)
elif key == "solo":
# e.g. "123"
s_pos = Position.fromstring(text, -1)
e_pos = Position.fromstring(text)
elif key in ("pair", "within", "oneof"):
s, e = text.split("..")
# Attempt to fix features that span the origin
s_pos = Position.fromstring(s, -1)
e_pos = Position.fromstring(e)
# We have seen Ensembl data in "GenBank Format" with length zero in the LOCUS
# and variation features with s_pos >= e_pos - they are not origin wrapping!
if e_pos <= s_pos and length and s_pos < length:
# Assuming this is meant to be origin wrapping.
# Create a CompoundLocation of the wrapped feature,
# consisting of two SimpleLocation objects to extend to
# the list of feature locations.
if not circular:
raise LocationParserError(
f"it appears that '{text}' is a feature that spans the"
" origin, but the sequence topology is undefined"
)
warnings.warn(
f"Attempting to fix invalid location {text!r} as it looks"
" like incorrect origin wrapping. Please fix input file,"
" this could have unintended behavior.",
BiopythonParserWarning,
)
f1 = SimpleLocation(s_pos, length, strand)
f2 = SimpleLocation(0, e_pos, strand)
if strand == -1:
# For complementary features spanning the origin
return f2 + f1
else:
return f1 + f2
elif key == "between":
# A between location like "67^68" (one based counting) is a
# special case (note it has zero length). In python slice
# notation this is 67:67, a zero length slice. See Bug 2622
# Further more, on a circular genome of length N you can have
# a location N^1 meaning the junction at the origin. See Bug 3098.
# NOTE - We can imagine between locations like "2^4", but this
# is just "3". Similarly, "2^5" is just "3..4"
s, e = text.split("^")
s = int(s)
e = int(e)
if s + 1 == e or (s == length and e == 1):
s_pos = ExactPosition(s)
e_pos = s_pos
else:
raise LocationParserError(f"invalid feature location '{text}'")
if s_pos < 0:
raise LocationParserError(
f"negative starting position in feature location '{text}'"
)
return SimpleLocation(s_pos, e_pos, strand, ref=ref)
def _get_strand(self):
"""Get function for the strand property (PRIVATE)."""
return self._strand
def _set_strand(self, value):
"""Set function for the strand property (PRIVATE)."""
if value not in [+1, -1, 0, None]:
raise ValueError(f"Strand should be +1, -1, 0 or None, not {value!r}")
self._strand = value
strand = property(
fget=_get_strand,
fset=_set_strand,
doc="Strand of the location (+1, -1, 0 or None).",
)
def __str__(self):
"""Return a representation of the SimpleLocation object (with python counting).
For the simple case this uses the python splicing syntax, [122:150]
(zero based counting) which GenBank would call 123..150 (one based
counting).
"""
answer = f"[{self._start}:{self._end}]"
if self.ref and self.ref_db:
answer = f"{self.ref_db}:{self.ref}{answer}"
elif self.ref:
answer = self.ref + answer
# Is ref_db without ref meaningful?
if self.strand is None:
return answer
elif self.strand == +1:
return answer + "(+)"
elif self.strand == -1:
return answer + "(-)"
else:
# strand = 0, stranded but strand unknown, ? in GFF3
return answer + "(?)"
def __repr__(self):
"""Represent the SimpleLocation object as a string for debugging."""
optional = ""
if self.strand is not None:
optional += f", strand={self.strand!r}"
if self.ref is not None:
optional += f", ref={self.ref!r}"
if self.ref_db is not None:
optional += f", ref_db={self.ref_db!r}"
return f"{self.__class__.__name__}({self.start!r}, {self.end!r}{optional})"
def __add__(self, other):
"""Combine location with another SimpleLocation object, or shift it.
You can add two feature locations to make a join CompoundLocation:
>>> from Bio.SeqFeature import SimpleLocation
>>> f1 = SimpleLocation(5, 10)
>>> f2 = SimpleLocation(20, 30)
>>> combined = f1 + f2
>>> print(combined)
join{[5:10], [20:30]}
This is thus equivalent to:
>>> from Bio.SeqFeature import CompoundLocation
>>> join = CompoundLocation([f1, f2])
>>> print(join)
join{[5:10], [20:30]}
You can also use sum(...) in this way:
>>> join = sum([f1, f2])
>>> print(join)
join{[5:10], [20:30]}
Furthermore, you can combine a SimpleLocation with a CompoundLocation
in this way.
Separately, adding an integer will give a new SimpleLocation with
its start and end offset by that amount. For example:
>>> print(f1)
[5:10]
>>> print(f1 + 100)
[105:110]
>>> print(200 + f1)
[205:210]
This can be useful when editing annotation.
"""
if isinstance(other, SimpleLocation):
return CompoundLocation([self, other])
elif isinstance(other, int):
return self._shift(other)
else:
# This will allow CompoundLocation's __radd__ to be called:
return NotImplemented
def __radd__(self, other):
"""Return a SimpleLocation object by shifting the location by an integer amount."""
if isinstance(other, int):
return self._shift(other)
else:
return NotImplemented
def __sub__(self, other):
"""Subtracting an integer will shift the start and end by that amount.
>>> from Bio.SeqFeature import SimpleLocation
>>> f1 = SimpleLocation(105, 150)
>>> print(f1)
[105:150]
>>> print(f1 - 100)
[5:50]
This can be useful when editing annotation. You can also add an integer
to a feature location (which shifts in the opposite direction).
"""
if isinstance(other, int):
return self._shift(-other)
else:
return NotImplemented
def __nonzero__(self):
"""Return True regardless of the length of the feature.
This behavior is for backwards compatibility, since until the
__len__ method was added, a SimpleLocation always evaluated as True.
Note that in comparison, Seq objects, strings, lists, etc, will all
evaluate to False if they have length zero.
WARNING: The SimpleLocation may in future evaluate to False when its
length is zero (in order to better match normal python behavior)!
"""
return True
def __len__(self):
"""Return the length of the region described by the SimpleLocation object.
Note that extra care may be needed for fuzzy locations, e.g.
>>> from Bio.SeqFeature import SimpleLocation
>>> from Bio.SeqFeature import BeforePosition, AfterPosition
>>> loc = SimpleLocation(BeforePosition(5), AfterPosition(10))
>>> len(loc)
5
"""
return int(self._end) - int(self._start)
def __contains__(self, value):
"""Check if an integer position is within the SimpleLocation object.
Note that extra care may be needed for fuzzy locations, e.g.
>>> from Bio.SeqFeature import SimpleLocation
>>> from Bio.SeqFeature import BeforePosition, AfterPosition
>>> loc = SimpleLocation(BeforePosition(5), AfterPosition(10))
>>> len(loc)
5
>>> [i for i in range(15) if i in loc]
[5, 6, 7, 8, 9]
"""
if not isinstance(value, int):
raise ValueError(
"Currently we only support checking for integer "
"positions being within a SimpleLocation."
)
if value < self._start or value >= self._end:
return False
else:
return True
def __iter__(self):
"""Iterate over the parent positions within the SimpleLocation object.
>>> from Bio.SeqFeature import SimpleLocation
>>> from Bio.SeqFeature import BeforePosition, AfterPosition
>>> loc = SimpleLocation(BeforePosition(5), AfterPosition(10))
>>> len(loc)
5
>>> for i in loc: print(i)
5
6
7
8
9
>>> list(loc)
[5, 6, 7, 8, 9]
>>> [i for i in range(15) if i in loc]
[5, 6, 7, 8, 9]
Note this is strand aware:
>>> loc = SimpleLocation(BeforePosition(5), AfterPosition(10), strand = -1)
>>> list(loc)
[9, 8, 7, 6, 5]
"""
if self.strand == -1:
yield from range(self._end - 1, self._start - 1, -1)
else:
yield from range(self._start, self._end)
def __eq__(self, other):
"""Implement equality by comparing all the location attributes."""
if not isinstance(other, SimpleLocation):
return False
return (
self._start == other.start
and self._end == other.end
and self._strand == other.strand
and self.ref == other.ref
and self.ref_db == other.ref_db
)
def _shift(self, offset):
"""Return a copy of the SimpleLocation shifted by an offset (PRIVATE).
Returns self when location is relative to an external reference.
"""
# TODO - What if offset is a fuzzy position?
if self.ref or self.ref_db:
return self
return SimpleLocation(
start=self._start + offset,
end=self._end + offset,
strand=self.strand,
)
def _flip(self, length):
"""Return a copy of the location after the parent is reversed (PRIVATE).
Returns self when location is relative to an external reference.
"""
if self.ref or self.ref_db:
return self
# Note this will flip the start and end too!
if self.strand == +1:
flip_strand = -1
elif self.strand == -1:
flip_strand = +1
else:
# 0 or None
flip_strand = self.strand
return SimpleLocation(
start=self._end._flip(length),
end=self._start._flip(length),
strand=flip_strand,
)
@property
def parts(self):
"""Read only list of sections (always one, the SimpleLocation object).
This is a convenience property allowing you to write code handling
both SimpleLocation objects (with one part) and more complex
CompoundLocation objects (with multiple parts) interchangeably.
"""
return [self]
@property
def start(self):
"""Start location - left most (minimum) value, regardless of strand.
Read only, returns an integer like position object, possibly a fuzzy
position.
"""
return self._start
@property
def end(self):
"""End location - right most (maximum) value, regardless of strand.
Read only, returns an integer like position object, possibly a fuzzy
position.
"""
return self._end
def extract(self, parent_sequence, references=None):
"""Extract the sequence from supplied parent sequence using the SimpleLocation object.
The parent_sequence can be a Seq like object or a string, and will
generally return an object of the same type. The exception to this is
a MutableSeq as the parent sequence will return a Seq object.
If the location refers to other records, they must be supplied
in the optional dictionary references.
>>> from Bio.Seq import Seq
>>> from Bio.SeqFeature import SimpleLocation
>>> seq = Seq("MKQHKAMIVALIVICITAVVAAL")
>>> feature_loc = SimpleLocation(8, 15)
>>> feature_loc.extract(seq)
Seq('VALIVIC')
"""
if self.ref or self.ref_db:
if not references:
raise ValueError(
f"Feature references another sequence ({self.ref}),"
" references mandatory"
)
elif self.ref not in references:
# KeyError?
raise ValueError(
f"Feature references another sequence ({self.ref}),"
" not found in references"
)
parent_sequence = references[self.ref]
f_seq = parent_sequence[int(self.start) : int(self.end)]
if isinstance(f_seq, MutableSeq):
f_seq = Seq(f_seq)
if self.strand == -1:
f_seq = reverse_complement(f_seq)
return f_seq
FeatureLocation = SimpleLocation # OBSOLETE; for backward compatibility only.
class CompoundLocation(Location):
"""For handling joins etc where a feature location has several parts."""
def __init__(self, parts, operator="join"):
"""Initialize the class.
>>> from Bio.SeqFeature import SimpleLocation, CompoundLocation
>>> f1 = SimpleLocation(10, 40, strand=+1)
>>> f2 = SimpleLocation(50, 59, strand=+1)
>>> f = CompoundLocation([f1, f2])
>>> len(f) == len(f1) + len(f2) == 39 == len(list(f))
True
>>> print(f.operator)
join
>>> 5 in f
False
>>> 15 in f
True
>>> f.strand
1
Notice that the strand of the compound location is computed
automatically - in the case of mixed strands on the sub-locations
the overall strand is set to None.
>>> f = CompoundLocation([SimpleLocation(3, 6, strand=+1),
... SimpleLocation(10, 13, strand=-1)])
>>> print(f.strand)
None
>>> len(f)
6
>>> list(f)
[3, 4, 5, 12, 11, 10]
The example above doing list(f) iterates over the coordinates within the
feature. This allows you to use max and min on the location, to find the
range covered:
>>> min(f)
3
>>> max(f)
12
More generally, you can use the compound location's start and end which
give the full span covered, 0 <= start <= end <= full sequence length.
>>> f.start == min(f)
True
>>> f.end == max(f) + 1
True
This is consistent with the behavior of the SimpleLocation for a single
region, where again the 'start' and 'end' do not necessarily give the
biological start and end, but rather the 'minimal' and 'maximal'
coordinate boundaries.
Note that adding locations provides a more intuitive method of
construction:
>>> f = SimpleLocation(3, 6, strand=+1) + SimpleLocation(10, 13, strand=-1)
>>> len(f)
6
>>> list(f)
[3, 4, 5, 12, 11, 10]
"""
self.operator = operator
self.parts = list(parts)
for loc in self.parts:
if not isinstance(loc, SimpleLocation):
raise ValueError(
"CompoundLocation should be given a list of "
"SimpleLocation objects, not %s" % loc.__class__
)
if len(parts) < 2:
raise ValueError(
f"CompoundLocation should have at least 2 parts, not {parts!r}"
)
def __str__(self):
"""Return a representation of the CompoundLocation object (with python counting)."""
return "%s{%s}" % (self.operator, ", ".join(str(loc) for loc in self.parts))
def __repr__(self):
"""Represent the CompoundLocation object as string for debugging."""
return f"{self.__class__.__name__}({self.parts!r}, {self.operator!r})"
def _get_strand(self):
"""Get function for the strand property (PRIVATE)."""
# Historically a join on the reverse strand has been represented
# in Biopython with both the parent SeqFeature and its children
# (the exons for a CDS) all given a strand of -1. Likewise, for
# a join feature on the forward strand they all have strand +1.
# However, we must also consider evil mixed strand examples like
# this, join(complement(69611..69724),139856..140087,140625..140650)
if len({loc.strand for loc in self.parts}) == 1:
return self.parts[0].strand
else:
return None # i.e. mixed strands
def _set_strand(self, value):
"""Set function for the strand property (PRIVATE)."""
# Should this be allowed/encouraged?
for loc in self.parts:
loc.strand = value
strand = property(
fget=_get_strand,
fset=_set_strand,
doc="""Overall strand of the compound location.
If all the parts have the same strand, that is returned. Otherwise
for mixed strands, this returns None.
>>> from Bio.SeqFeature import SimpleLocation, CompoundLocation
>>> f1 = SimpleLocation(15, 17, strand=1)
>>> f2 = SimpleLocation(20, 30, strand=-1)
>>> f = f1 + f2
>>> f1.strand
1
>>> f2.strand
-1
>>> f.strand
>>> f.strand is None
True
If you set the strand of a CompoundLocation, this is applied to
all the parts - use with caution:
>>> f.strand = 1
>>> f1.strand
1
>>> f2.strand
1
>>> f.strand
1
""",
)
def __add__(self, other):
"""Combine locations, or shift the location by an integer offset.
>>> from Bio.SeqFeature import SimpleLocation
>>> f1 = SimpleLocation(15, 17) + SimpleLocation(20, 30)
>>> print(f1)
join{[15:17], [20:30]}
You can add another SimpleLocation:
>>> print(f1 + SimpleLocation(40, 50))
join{[15:17], [20:30], [40:50]}
>>> print(SimpleLocation(5, 10) + f1)
join{[5:10], [15:17], [20:30]}
You can also add another CompoundLocation:
>>> f2 = SimpleLocation(40, 50) + SimpleLocation(60, 70)
>>> print(f2)
join{[40:50], [60:70]}
>>> print(f1 + f2)
join{[15:17], [20:30], [40:50], [60:70]}
Also, as with the SimpleLocation, adding an integer shifts the
location's coordinates by that offset:
>>> print(f1 + 100)
join{[115:117], [120:130]}
>>> print(200 + f1)
join{[215:217], [220:230]}
>>> print(f1 + (-5))
join{[10:12], [15:25]}
"""
if isinstance(other, SimpleLocation):
return CompoundLocation(self.parts + [other], self.operator)
elif isinstance(other, CompoundLocation):
if self.operator != other.operator:
# Handle join+order -> order as a special case?
raise ValueError(
f"Mixed operators {self.operator} and {other.operator}"
)
return CompoundLocation(self.parts + other.parts, self.operator)
elif isinstance(other, int):
return self._shift(other)
else:
raise NotImplementedError
def __radd__(self, other):
"""Add a feature to the left."""
if isinstance(other, SimpleLocation):
return CompoundLocation([other] + self.parts, self.operator)
elif isinstance(other, int):
return self._shift(other)
else:
raise NotImplementedError
def __contains__(self, value):
"""Check if an integer position is within the CompoundLocation object."""
for loc in self.parts:
if value in loc:
return True
return False
def __nonzero__(self):
"""Return True regardless of the length of the feature.
This behavior is for backwards compatibility, since until the
__len__ method was added, a SimpleLocation always evaluated as True.
Note that in comparison, Seq objects, strings, lists, etc, will all
evaluate to False if they have length zero.
WARNING: The SimpleLocation may in future evaluate to False when its
length is zero (in order to better match normal python behavior)!
"""
return True
def __len__(self):
"""Return the length of the CompoundLocation object."""
return sum(len(loc) for loc in self.parts)
def __iter__(self):
"""Iterate over the parent positions within the CompoundLocation object."""
for loc in self.parts:
yield from loc
def __eq__(self, other):
"""Check if all parts of CompoundLocation are equal to all parts of other CompoundLocation."""
if not isinstance(other, CompoundLocation):
return False
if len(self.parts) != len(other.parts):
return False
if self.operator != other.operator:
return False
for self_part, other_part in zip(self.parts, other.parts):
if self_part != other_part:
return False
return True
def _shift(self, offset):
"""Return a copy of the CompoundLocation shifted by an offset (PRIVATE)."""
return CompoundLocation(
[loc._shift(offset) for loc in self.parts], self.operator
)
def _flip(self, length):
"""Return a copy of the locations after the parent is reversed (PRIVATE).
Note that the order of the parts is NOT reversed unless all parts
have strand=None, since the order has meaning for stranded features.
Consider a CDS on the forward strand with exons small, medium
and large (in length). Once we change the frame of reference
to the reverse complement strand, the start codon is still part of
the small exon, and the stop codon still part of the large exon -
so the part order remains the same!
Here is an artificial example, were the features map to the two upper
case regions and the lower case runs of n are not used:
>>> from Bio.Seq import Seq
>>> from Bio.SeqFeature import SimpleLocation
>>> dna = Seq("nnnnnAGCATCCTGCTGTACnnnnnnnnGAGAMTGCCATGCCCCTGGAGTGAnnnnn")
>>> small = SimpleLocation(5, 20, strand=1)
>>> large = SimpleLocation(28, 52, strand=1)
>>> location = small + large
>>> print(small)
[5:20](+)
>>> print(large)
[28:52](+)
>>> print(location)
join{[5:20](+), [28:52](+)}
>>> for part in location.parts:
... print(len(part))
...
15
24
As you can see, this is a silly example where each "exon" is a word:
>>> print(small.extract(dna).translate())
SILLY
>>> print(large.extract(dna).translate())
EXAMPLE*
>>> print(location.extract(dna).translate())
SILLYEXAMPLE*
>>> for part in location.parts:
... print(part.extract(dna).translate())
...
SILLY
EXAMPLE*
Now, let's look at this from the reverse strand frame of reference:
>>> flipped_dna = dna.reverse_complement()
>>> flipped_location = location._flip(len(dna))
>>> print(flipped_location.extract(flipped_dna).translate())
SILLYEXAMPLE*
>>> for part in flipped_location.parts:
... print(part.extract(flipped_dna).translate())
...
SILLY
EXAMPLE*
The key point here is the first part of the CompoundFeature is still the
small exon, while the second part is still the large exon:
>>> for part in flipped_location.parts:
... print(len(part))
...
15
24
>>> print(flipped_location)
join{[37:52](-), [5:29](-)}
Notice the parts are not reversed. However, there was a bug here in older
versions of Biopython which would have given join{[5:29](-), [37:52](-)}
and the translation would have wrongly been "EXAMPLE*SILLY" instead.
When all the parts have strand None, the order of the parts is reversed.
In principle this does not change the meaning of the location, but improves
the representation of feature locations spanning the origin in circular
molecules.
>>> loc = SimpleLocation(4, 6, None) + SimpleLocation(0, 1, None)
>>> print(loc)
join{[4:6], [0:1]}
>>> print(loc._flip(6))
join{[5:6], [0:2]}
join{[0:2], [5:6]} would not be properly represented in SnapGene, Benchling, etc.
"""
if all(loc.strand is None for loc in self.parts):
return CompoundLocation(
[loc._flip(length) for loc in self.parts[::-1]], self.operator
)
else:
return CompoundLocation(
[loc._flip(length) for loc in self.parts], self.operator
)
@property
def start(self):
"""Start location - left most (minimum) value, regardless of strand.
Read only, returns an integer like position object, possibly a fuzzy
position.
For the special case of a CompoundLocation wrapping the origin of a
circular genome, this will return zero.
"""
return min(loc.start for loc in self.parts)
@property
def end(self):
"""End location - right most (maximum) value, regardless of strand.
Read only, returns an integer like position object, possibly a fuzzy
position.
For the special case of a CompoundLocation wrapping the origin of
a circular genome this will match the genome length.
"""
return max(loc.end for loc in self.parts)
@property
def ref(self):
"""Not present in CompoundLocation, dummy method for API compatibility."""
return None
@property
def ref_db(self):
"""Not present in CompoundLocation, dummy method for API compatibility."""
return None
def extract(self, parent_sequence, references=None):
"""Extract the sequence from supplied parent sequence using the CompoundLocation object.
The parent_sequence can be a Seq like object or a string, and will
generally return an object of the same type. The exception to this is
a MutableSeq as the parent sequence will return a Seq object.
If the location refers to other records, they must be supplied
in the optional dictionary references.
>>> from Bio.Seq import Seq
>>> from Bio.SeqFeature import SimpleLocation, CompoundLocation
>>> seq = Seq("MKQHKAMIVALIVICITAVVAAL")
>>> fl1 = SimpleLocation(2, 8)
>>> fl2 = SimpleLocation(10, 15)
>>> fl3 = CompoundLocation([fl1,fl2])
>>> fl3.extract(seq)
Seq('QHKAMILIVIC')
"""
# This copes with mixed strand features & all on reverse:
parts = [
loc.extract(parent_sequence, references=references) for loc in self.parts
]
f_seq = functools.reduce(lambda x, y: x + y, parts)
return f_seq
class Position(ABC):
"""Abstract base class representing a position."""
@abstractmethod
def __repr__(self):
"""Represent the Position object as a string for debugging."""
return f"{self.__class__.__name__}(...)"
@staticmethod
def fromstring(text, offset=0):
"""Build a Position object from the text string.
For an end position, leave offset as zero (default):
>>> Position.fromstring("5")
ExactPosition(5)
For a start position, set offset to minus one (for Python counting):
>>> Position.fromstring("5", -1)
ExactPosition(4)
This also covers fuzzy positions:
>>> p = Position.fromstring("<5")
>>> p
BeforePosition(5)
>>> print(p)
<5
>>> int(p)
5
>>> Position.fromstring(">5")
AfterPosition(5)
By default assumes an end position, so note the integer behavior:
>>> p = Position.fromstring("one-of(5,8,11)")
>>> p
OneOfPosition(11, choices=[ExactPosition(5), ExactPosition(8), ExactPosition(11)])
>>> print(p)
one-of(5,8,11)
>>> int(p)
11
>>> Position.fromstring("(8.10)")
WithinPosition(10, left=8, right=10)
Fuzzy start positions:
>>> p = Position.fromstring("<5", -1)
>>> p
BeforePosition(4)
>>> print(p)
<4
>>> int(p)
4
Notice how the integer behavior changes too!
>>> p = Position.fromstring("one-of(5,8,11)", -1)
>>> p
OneOfPosition(4, choices=[ExactPosition(4), ExactPosition(7), ExactPosition(10)])
>>> print(p)
one-of(4,7,10)
>>> int(p)
4
"""
if offset != 0 and offset != -1:
raise ValueError(
"To convert one-based indices to zero-based indices, offset must be either 0 (for end positions) or -1 (for start positions)."
)
if text == "?":
return UnknownPosition()
if text.startswith("?"):
return UncertainPosition(int(text[1:]) + offset)
if text.startswith("<"):
return BeforePosition(int(text[1:]) + offset)
if text.startswith(">"):
return AfterPosition(int(text[1:]) + offset)
m = _re_within_position.match(text)
if m is not None:
s, e = m.groups()
s = int(s) + offset
e = int(e) + offset
if offset == -1:
default = s
else:
default = e
return WithinPosition(default, left=s, right=e)
m = _re_oneof_position.match(text)
if m is not None:
positions = m.groups()[0]
parts = [ExactPosition(int(pos) + offset) for pos in positions.split(",")]
if offset == -1:
default = min(int(pos) for pos in parts)
else:
default = max(int(pos) for pos in parts)
return OneOfPosition(default, choices=parts)
return ExactPosition(int(text) + offset)
class ExactPosition(int, Position):
"""Specify the specific position of a boundary.
Arguments:
- position - The position of the boundary.
- extension - An optional argument which must be zero since we don't
have an extension. The argument is provided so that the same number
of arguments can be passed to all position types.
In this case, there is no fuzziness associated with the position.
>>> p = ExactPosition(5)
>>> p
ExactPosition(5)
>>> print(p)
5
>>> isinstance(p, Position)
True
>>> isinstance(p, int)
True
Integer comparisons and operations should work as expected:
>>> p == 5
True
>>> p < 6
True
>>> p <= 5
True
>>> p + 10
ExactPosition(15)
"""
def __new__(cls, position, extension=0):
"""Create an ExactPosition object."""
if extension != 0:
raise AttributeError(f"Non-zero extension {extension} for exact position.")
return int.__new__(cls, position)
# Must define this on Python 3.8 onwards because we redefine __repr__
def __str__(self):
"""Return a representation of the ExactPosition object (with python counting)."""
return str(int(self))
def __repr__(self):
"""Represent the ExactPosition object as a string for debugging."""
return "%s(%i)" % (self.__class__.__name__, int(self))
def __add__(self, offset):
"""Return a copy of the position object with its location shifted (PRIVATE)."""
# By default preserve any subclass
return self.__class__(int(self) + offset)
def _flip(self, length):
"""Return a copy of the location after the parent is reversed (PRIVATE)."""
# By default preserve any subclass
return self.__class__(length - int(self))
class UncertainPosition(ExactPosition):
"""Specify a specific position which is uncertain.
This is used in UniProt, e.g. ?222 for uncertain position 222, or in the
XML format explicitly marked as uncertain. Does not apply to GenBank/EMBL.
"""
class UnknownPosition(Position):
"""Specify a specific position which is unknown (has no position).
This is used in UniProt, e.g. ? or in the XML as unknown.
"""
def __repr__(self):
"""Represent the UnknownPosition object as a string for debugging."""
return f"{self.__class__.__name__}()"
def __hash__(self):
"""Return the hash value of the UnknownPosition object."""
return hash(None)
def __add__(self, offset):
"""Return a copy of the position object with its location shifted (PRIVATE)."""
return self
def _flip(self, length):
"""Return a copy of the location after the parent is reversed (PRIVATE)."""
return self
class WithinPosition(int, Position):
"""Specify the position of a boundary within some coordinates.
Arguments:
- position - The default integer position
- left - The start (left) position of the boundary
- right - The end (right) position of the boundary
This allows dealing with a location like ((11.14)..100). This
indicates that the start of the sequence is somewhere between 11
and 14. Since this is a start coordinate, it should act like
it is at position 11 (or in Python counting, 10).
>>> p = WithinPosition(10, 10, 13)
>>> p
WithinPosition(10, left=10, right=13)
>>> print(p)
(10.13)
>>> int(p)
10
Basic integer comparisons and operations should work as though
this were a plain integer:
>>> p == 10
True
>>> p in [9, 10, 11]
True
>>> p < 11
True
>>> p + 10
WithinPosition(20, left=20, right=23)
>>> isinstance(p, WithinPosition)
True
>>> isinstance(p, Position)
True
>>> isinstance(p, int)
True
Note this also applies for comparison to other position objects,
where again the integer behavior is used:
>>> p == 10
True
>>> p == ExactPosition(10)
True
>>> p == BeforePosition(10)
True
>>> p == AfterPosition(10)
True
If this were an end point, you would want the position to be 13
(the right/larger value, not the left/smaller value as above):
>>> p2 = WithinPosition(13, 10, 13)
>>> p2
WithinPosition(13, left=10, right=13)
>>> print(p2)
(10.13)
>>> int(p2)
13
>>> p2 == 13
True
>>> p2 == ExactPosition(13)
True
"""
def __new__(cls, position, left, right):
"""Create a WithinPosition object."""
if not (position == left or position == right):
raise RuntimeError(
"WithinPosition: %r should match left %r or "
"right %r" % (position, left, right)
)
obj = int.__new__(cls, position)
obj._left = left
obj._right = right
return obj
def __getnewargs__(self):
"""Return the arguments accepted by __new__.
Necessary to allow pickling and unpickling of class instances.
"""
return (int(self), self._left, self._right)
def __repr__(self):
"""Represent the WithinPosition object as a string for debugging."""
return "%s(%i, left=%i, right=%i)" % (
self.__class__.__name__,
int(self),
self._left,
self._right,
)
def __str__(self):
"""Return a representation of the WithinPosition object (with python counting)."""
return f"({self._left}.{self._right})"
def __add__(self, offset):
"""Return a copy of the position object with its location shifted."""
return self.__class__(
int(self) + offset, self._left + offset, self._right + offset
)
def _flip(self, length):
"""Return a copy of the location after the parent is reversed (PRIVATE)."""
return self.__class__(
length - int(self), length - self._right, length - self._left
)
class BetweenPosition(int, Position):
"""Specify the position of a boundary between two coordinates (OBSOLETE?).
Arguments:
- position - The default integer position
- left - The start (left) position of the boundary
- right - The end (right) position of the boundary
This allows dealing with a position like 123^456. This
indicates that the start of the sequence is somewhere between
123 and 456. It is up to the parser to set the position argument
to either boundary point (depending on if this is being used as
a start or end of the feature). For example as a feature end:
>>> p = BetweenPosition(456, 123, 456)
>>> p
BetweenPosition(456, left=123, right=456)
>>> print(p)
(123^456)
>>> int(p)
456
Integer equality and comparison use the given position,
>>> p == 456
True
>>> p in [455, 456, 457]
True
>>> p > 300
True
The old legacy properties of position and extension give the
starting/lower/left position as an integer, and the distance
to the ending/higher/right position as an integer. Note that
the position object will act like either the left or the right
end-point depending on how it was created:
>>> p2 = BetweenPosition(123, left=123, right=456)
>>> int(p) == int(p2)
False
>>> p == 456
True
>>> p2 == 123
True
Note this potentially surprising behavior:
>>> BetweenPosition(123, left=123, right=456) == ExactPosition(123)
True
>>> BetweenPosition(123, left=123, right=456) == BeforePosition(123)
True
>>> BetweenPosition(123, left=123, right=456) == AfterPosition(123)
True
i.e. For equality (and sorting) the position objects behave like
integers.
"""
def __new__(cls, position, left, right):
"""Create a new instance in BetweenPosition object."""
assert position == left or position == right
# TODO - public API for getting left/right, especially the unknown one
obj = int.__new__(cls, position)
obj._left = left
obj._right = right
return obj
def __getnewargs__(self):
"""Return the arguments accepted by __new__.
Necessary to allow pickling and unpickling of class instances.
"""
return (int(self), self._left, self._right)
def __repr__(self):
"""Represent the BetweenPosition object as a string for debugging."""
return "%s(%i, left=%i, right=%i)" % (
self.__class__.__name__,
int(self),
self._left,
self._right,
)
def __str__(self):
"""Return a representation of the BetweenPosition object (with python counting)."""
return f"({self._left}^{self._right})"
def __add__(self, offset):
"""Return a copy of the position object with its location shifted (PRIVATE)."""
return self.__class__(
int(self) + offset, self._left + offset, self._right + offset
)
def _flip(self, length):
"""Return a copy of the location after the parent is reversed (PRIVATE)."""
return self.__class__(
length - int(self), length - self._right, length - self._left
)
class BeforePosition(int, Position):
"""Specify a position where the actual location occurs before it.
Arguments:
- position - The upper boundary of where the location can occur.
- extension - An optional argument which must be zero since we don't
have an extension. The argument is provided so that the same number
of arguments can be passed to all position types.
This is used to specify positions like (<10..100) where the location
occurs somewhere before position 10.
>>> p = BeforePosition(5)
>>> p
BeforePosition(5)
>>> print(p)
<5
>>> int(p)
5
>>> p + 10
BeforePosition(15)
Note this potentially surprising behavior:
>>> p == ExactPosition(5)
True
>>> p == AfterPosition(5)
True
Just remember that for equality and sorting the position objects act
like integers.
"""
# Subclasses int so can't use __init__
def __new__(cls, position, extension=0):
"""Create a new instance in BeforePosition object."""
if extension != 0:
raise AttributeError(f"Non-zero extension {extension} for exact position.")
return int.__new__(cls, position)
def __repr__(self):
"""Represent the location as a string for debugging."""
return "%s(%i)" % (self.__class__.__name__, int(self))
def __str__(self):
"""Return a representation of the BeforePosition object (with python counting)."""
return f"<{int(self)}"
def __add__(self, offset):
"""Return a copy of the position object with its location shifted (PRIVATE)."""
return self.__class__(int(self) + offset)
def _flip(self, length):
"""Return a copy of the location after the parent is reversed (PRIVATE)."""
return AfterPosition(length - int(self))
class AfterPosition(int, Position):
"""Specify a position where the actual location is found after it.
Arguments:
- position - The lower boundary of where the location can occur.
- extension - An optional argument which must be zero since we don't
have an extension. The argument is provided so that the same number
of arguments can be passed to all position types.
This is used to specify positions like (>10..100) where the location
occurs somewhere after position 10.
>>> p = AfterPosition(7)
>>> p
AfterPosition(7)
>>> print(p)
>7
>>> int(p)
7
>>> p + 10
AfterPosition(17)
>>> isinstance(p, AfterPosition)
True
>>> isinstance(p, Position)
True
>>> isinstance(p, int)
True
Note this potentially surprising behavior:
>>> p == ExactPosition(7)
True
>>> p == BeforePosition(7)
True
Just remember that for equality and sorting the position objects act
like integers.
"""
# Subclasses int so can't use __init__
def __new__(cls, position, extension=0):
"""Create a new instance of the AfterPosition object."""
if extension != 0:
raise AttributeError(f"Non-zero extension {extension} for exact position.")
return int.__new__(cls, position)
def __repr__(self):
"""Represent the location as a string for debugging."""
return "%s(%i)" % (self.__class__.__name__, int(self))
def __str__(self):
"""Return a representation of the AfterPosition object (with python counting)."""
return f">{int(self)}"
def __add__(self, offset):
"""Return a copy of the position object with its location shifted (PRIVATE)."""
return self.__class__(int(self) + offset)
def _flip(self, length):
"""Return a copy of the location after the parent is reversed (PRIVATE)."""
return BeforePosition(length - int(self))
class OneOfPosition(int, Position):
"""Specify a position where the location can be multiple positions.
This models the GenBank 'one-of(1888,1901)' function, and tries
to make this fit within the Biopython Position models. If this was
a start position it should act like 1888, but as an end position 1901.
>>> p = OneOfPosition(1888, [ExactPosition(1888), ExactPosition(1901)])
>>> p
OneOfPosition(1888, choices=[ExactPosition(1888), ExactPosition(1901)])
>>> int(p)
1888
Integer comparisons and operators act like using int(p),
>>> p == 1888
True
>>> p <= 1888
True
>>> p > 1888
False
>>> p + 100
OneOfPosition(1988, choices=[ExactPosition(1988), ExactPosition(2001)])
>>> isinstance(p, OneOfPosition)
True
>>> isinstance(p, Position)
True
>>> isinstance(p, int)
True
"""
def __new__(cls, position, choices):
"""Initialize with a set of possible positions.
choices is a list of Position derived objects, specifying possible
locations.
position is an integer specifying the default behavior.
"""
if position not in choices:
raise ValueError(
f"OneOfPosition: {position!r} should match one of {choices!r}"
)
obj = int.__new__(cls, position)
obj.position_choices = choices
return obj
def __getnewargs__(self):
"""Return the arguments accepted by __new__.
Necessary to allow pickling and unpickling of class instances.
"""
return (int(self), self.position_choices)
def __repr__(self):
"""Represent the OneOfPosition object as a string for debugging."""
return "%s(%i, choices=%r)" % (
self.__class__.__name__,
int(self),
self.position_choices,
)
def __str__(self):
"""Return a representation of the OneOfPosition object (with python counting)."""
out = "one-of("
for position in self.position_choices:
out += f"{position},"
# replace the last comma with the closing parenthesis
return out[:-1] + ")"
def __add__(self, offset):
"""Return a copy of the position object with its location shifted (PRIVATE)."""
return self.__class__(
int(self) + offset, [p + offset for p in self.position_choices]
)
def _flip(self, length):
"""Return a copy of the location after the parent is reversed (PRIVATE)."""
return self.__class__(
length - int(self), [p._flip(length) for p in self.position_choices[::-1]]
)
if __name__ == "__main__":
from Bio._utils import run_doctest
run_doctest()